Table 1

Primer sequences used for amplification of carotenoid genes from pepper

GeneGenbank accession no.Fragment size, bpPrimer sequence (5′–3′)
Ggpps X80267 1,200F GAACCTTGTTGATTTATGGGC
R CCAACATAAGCACACTGAAAG
Psy X68017 1,200F TGGGCATCGCACCTGAATCAA
R GTCCAGTATCCTGCGGTACAA
Pds X68058 420F TTCGACTTGTTTCTGCTGTCA
R CATCCCTTGCCTCCAGCAGTA
Zds X89897 400F GCTCCAAAAGGGCTATTTCC
R TCCCATTTCAATGTGGTTCC
Ze X91491 1,900F ATGGCATAAGGTCTAAGGTAC
R CTCAGATAGTCTGCAATGTTG
Ccs X77289 1,490F CTAATGGAAACCCTTCTAAAGC
R AATTCAAAGGCTCTCTATTGCT
  • F, forward; R, reverse.