Table 2

Multicopy insertion sequences

Element/family copiesLength/DR*StructureSimilarity/speciesTerminal inverted repeats (5′-3′)
IS511IS3412664orfA/orfBself C. crescentus TGACCTGCCCCTGATTTTTT
TGACCTGCCTCTGATCTTTC
IS298IS548454orfA/orfBself C. crescentus GTGGTGTGGACTCTAAGGAT
GCGGTGTGGACACTTATCGC
ISCc1IS55§8484orfA/orfBIS298 C. crescentus GCCGTAGTGACGATTTAGGA
GTGGCGGTGACCATTTAGCT
ISCc2IS110411402orfAIS492 Pseudomonas atlantica TATCTGGATTGCAGCGCCAT
TGTCTGGATCGTCAAGCGGC
ISCc3IS3315142orfA/orfBISD1 Desulfovibrio vulgaris TGTCCGCCGTCAGCGCCAAT
TGTACGTCGTCAGAAGTTTT
  • * Size in base pairs of the element (Length) and the direct repeat (DR) generated by insertion into the chromosomal target site. 

  • IS511 gi/1103856/gb/U39501.1/CCU39501[1103856]. 

  • IS298 gi/4836363/gb/AF117124.1/AF117124[4836363]. 

  • § One copy of ISCc1 is truncated. 

  • All four copies of ISCc2 occur at the same position in an abundant DNA repeat and may represent a single insertion event.