Table 1.

Primer Sequences 5 → 3

Gene nameForwardReverse
OsteocalcinGACTGTGACGAGTTGGCTGAGCAAGGGGAAGAGGAAAGAA
ALPGGAACTCCTGACCCTTGACCTCCTGTTCAGCTCGTACTGC
CBF-αCCTCTGACTTCTGCCTCTGGTATGGAGTGCTGCTGGTCTG
GAPDHACAGTCAGCCGCATCTTCTTACGACCAAATCCGTTGACTC