Table 2.

Sites of nucleotide variation in CTX prophages and RS1 elements

CTX prophage/RS1 element
rstArstB
StrainGene positionrstR27515216218325834535441445951654055857960677477–799096288291344cep-zot 80 Siteszot-ctxA* 1,197 to –74ctxB
N16961CTXETETCTTCCGGCTCGACTTCGTAATACGE4E
O395CTXCLCLT..TACT...AG.CCTTCGT.C7C
IB1346CTXMOZCLT..TAC...............TE3, 4C
IB1617CTXENVEnvTCGT...TATAGTC.......TE3, 4C
CIRS101CTXHYBET......................E3C
HCO1CTXHYBET.....................E5C6
  • Dots (.) indicate sequence identical to that of V. cholerae N16961; ( — ) indicates deletion. E or ET, El Tor type; C or CL, classical type; C6, cholera toxin type 6;Env, environmental type.

  • *ToxT binding site repeats.

  • 74 nucleotide before the start of ctxA.