Table 2.

Genomic location and affected bases of small indel mutations

ChrmPositionTypeRef seqAlt seqUpstream seqDownstream seq
282948304DELAGGGGTGCCGGATGCCTATTATAAAAACCCTT
44940849408INGGAAGGGAAAAATAAAAAAAGGA
4*6748767487INAACTTTTTCCCTTCACATCTTTTTCTTTTTCTTTTTCTTTT
4271299271301DELTGATCCACAGTAATAAATGTCAAAAAAA
4806439806440DELAGAGGGGCGGCCTTGGCGGCGGGGAGGCCTCTG
4914652914682DELCGGCTGGTTTCTTTTCAGCTGGGGCTTTGGACGTCTTTTTAGTGTATGTGTGTATG
5384833384833INAATGTATTCATGATGTGTTGTTGTTGTTGTT
6162303162304DELCTCTGCGCAGTTTTTTTTTCTGATTTTTATTTTTTT
7728202728203DELGTGATGCTGTCTTGTTTTGTATCGTCGTT
7904867904867INTTAGGAATGGGTAAAAAAATACAAGAA
8275558275559DELCACGGATACTACCAAATGCCGTAT
9248934248935DELATATGGTGTCGTTTTTTTATTTTTATTTTTTTTTT
9351612351613DELTATTAAACGGATATTTTTTTTTGCGTCC
10*121756121759DELAAAGAGAAAGGAAAAAAGTGTCCTTTT
10741950741950INAACCGACTCCAGCTACTGAGCGCATGGT
11364868364870DELGCTGTTTTTTTGTCAAACGAGTAATAGAATATA
11409353409354DELGAGATTCAAACCTCCCGGCTATAAGTTCTTTT
123561735626DELAATCCAGTAGAAAAGTGGGCTTAATGAGGGA
12199746199750DELGTCTTGAACCATTCTACTTTGGTGAAA
12311700311700INAAGGCGACAGTGCGGGGGACGATC
13444769444769INCCACACCCAAGGCAAAAAAAAATT
13511778511780DELTAATTATAATATATTTTAATAATTTATTTATTAATA
13565730565732DELCAGCTTTTTGAGAAAAGGGAAGATCCACA
13838018838019DELATACCCGGGAGATTTTTTTACTTTTGA
13910069910070DELTATCAACCACACTTTACTATAACAGAT
15107864107864INGGTGCGAAAGCGATTTTTGGAGA

Indels are often found next to simple repeats.

  • * Two of the indels involve tandem repeat sequences.