Table 3.

Genomic integration sites of the [6xP3-rubia] expression cassette

QueenGenomic sequence of integration site*Linkage groupPosition on the chromosome (bp)
Flanking BacRFlanking BacL
11–59TTCGGTTTGCTTTTTTTAAAGGATATGGTTGTAALG164474605
12–05TTTACATAAAATTTATTAAAAATTATATTAAATALG107083925
12–07CCGTCCGTTAATTAATTAATTCCACGATGAAAGALG121160164
12–31TTATTTTTAGAGTATTTAAAGTTAGGATGATTTTLG611531634
  • * BLASTn searches against the reference honeybee genome (genome assembly version 4.5).