Table S2.

Primers used for 4C-seq experiments

OrganismPrimerSequenceRead primer (DpnII) position
Zebrafishsix2a_DpnIIGAAGAGAGGCACAAAACTTTAGATCchr13:9797970
six2a_Csp6IGTCATCGCTTAGATAGACATACAAGTAC
six3a_DpnIIAGTGGGTGGAATATTATTGTGATCchr13:9826837
six3a_Csp6IAAGTGGTGAAAGCCTCTACGTAC
six2b_DpnIIGCTTACTACTAAGTAAAGTTTTTGAchr12:27140158
six2b_Csp6ITCATCAAATGCGGTTAAAGC
six3b_DpnIICCAGAAGCAGAGGGCGAchr12:27128597
six3b_Csp6ITCCAAGTACCATTGCCGAATA
six4a_DpnIIGCGCTGCAGAGTGCATTGATCchr13:31871941
six4a_Csp6ITGTTGTCAGATTGGGAATAGGGACC
six1a_DpnIIACTTCCGTGAGCTCTACAAGATCchr13:31845355
six1a_Csp6IGGCTCCCCTATGCAATCCAC
six6a_DpnIICAATGTTGCCAAACACACGAAGATCchr13:31826506
six6a_Csp6IGCCCTATACGCCAACTTCAAGTC
six4b_DpnIICCCACGACTCTCCCTCTTGATCchr20:20557180
six4b_Csp6ITCGTCTCTGCAGGATATGTGGTAC
six1b_DpnIIGTCTCTCCCGGCTTGCGATCchr20:20572332
six1b_Csp6IACTGTCGACTCATGTCGCGC
six6b_DpnIITGAGCTGTCAGATGTCTACGAGATCchr20:20606589
six6b_Csp6IGCCCTATACGCCAACTTCAAGTC
ppm1ba_DpnIIGCTGATATGCATGCAAGAchr13:10292253
ppm1ba_Csp6ICAATATTCAGAAATGAGCGAGT
slc3a1_DpnIICCGAATTCAACCGAAAGAchr13:10186394
slc3a1_Csp6ITGCGTTTGAAGGAATCTAGCGT
prepl_DpnIIGAGAGTGAATACACGCAGAchr13:10237450
prepl_Csp6ICACAAGTGGAGGTGGTGT
tm9sf3_DpnIICGTAAAATTGTTCAGCGAGTGATCchr13:9240919
tm9sf3_Csp6ICCTCTCGATGTGTTGGTGTAC
prdx3_DpnIIGAAGGTGAAGTCTGTTCAAAGATCchr13:9208662
prdx3_Csp6ICATAAAGGTGCTGCTGACGTAC
EnhIII(R5)_DpnIITACTCTCAGAGCTGTTAAAGGATCchr13:9877427
EnhIII(R5)_Csp6IGTTGCTGCATCTTCTGGAC
EnhVI(2.2)_DpnIIGGAGCCACGCGGATTAAGAGATCchr13:9763732
EnhVI(2.2)_Csp6IGATAGCCCACAGGAATTCGGCTG
MouseSix2_DpnIICGACTCCTGAGTCACAACGATCchr17:86087424
Six2_Csp6ICACTACATCGAGGCGGAGAAGC
Six3_DpnIIGCGCCCTCTGCGTAGAGATCchr17:86022535
Six3_Csp6ICCAGCAACTGTCAGCAGCCG
Six4_DpnIIGTCCCTGCCCCAGAGCgatcchr12:74213772
Six4_Csp6ITGCCTGCCCAGAAGTTCCGAG
Six1_DpnIIGGAATCCCTTCTCTCACTTGGATCchr12:74149274
Six1_Csp6IGGGGACTTATACGGGCTCTC
Six6_DpnIIACAGGGAGGGGAAGTGGATCchr12:74040426
Six6_Csp6ICCAGGAGGCAGAGAAGCTGC
Sea urchinSp_six4/5_DpnIICGCCACTTGAAACGGTGGGATCScaffold143:692728
Sp_six4/5_Csp6IAAAGTTCGCAGGGCTTTACATC
Sp_six1/2_DpnIICAAAAATAGGCGACAGCGAGATCScaffold143:780065
Sp_six1/2_Csp6IAGGATAGGGGTTGTGGGAGTAC
Sp_six3/6_DpnIIGCAATGGCAACTCCTCTCTTGAtcScaffold143:1022703
Sp_six3/6_Csp6ITTGGCCCCGTCGACAAGTAC