Table S3.

Human primer sequences used for qPCR

Gene nameForward primer sequenceReverse primer sequenceUPL probe no.
ACTB 5′- CCAACCGCGAGAAGATGA -3′5′- TCCATCACGATGCCAGTG -3′64
CCNA2 5′- CCATACCTCAAGTATTTGCCATC -3′5′- TCCAGTCTTTCGTATTAATGATTCAG-3′67
CCNB1 5′- CCAGTGCCAGTGTCTGAGC-3′5′- TGGAGAGGCAGTATCAACCA-3′21
CD36 5′- CCTCCTTGGCCTGATAGAAA-3′5′- GTTTGTGCTTGAGCCAGGTT-3′9
CDKN2A
(p16)
5′- GAGCAGCATGGAGCCTTC -3′5′- CGTAACTATTCGGTGCGTTG -3′67
DGAT2 5′- GAGGGGTCTGGGAGATGG-3′5′- TTGGACCTATTGAGCCAGGT-3′55
KLF9 5′- CTCCGAAAAGAGGCACAAGT-3′5′- CGGGAGAACTTTTTAAGGCAGT-3′76
LGR6 5′- TGTGCCAGCTTCTTCAAGG-3′5′- GGGCCTTTTTGAAGACTCCT-3′41
S100a3 5′- TCTGGTTCAGGTTCCTGACTG-3′5′- TGGAAGGTGCACACGATG-3′50
TUBA1A 5′- CTTCGTCTCCGCCATCAG -3′5′- TTGCCAATCTGGACACCA -3′58