Table S3.

Oligonucleotide sequence of ChIP primers

Binding siteNucleotide sequence (5′ to 3′)
SLC7A11 HIF-1 binding siteForward: ATCTTGGCTCACTGCAAGGT
Reverse: GATCGAGACCATCCTGGCTA
GCLM HIF-1 binding siteForward: AGCTGCTTCTGAGAACGAAAA
Reverse: CGCCTGGTGAGGTAGACAC
NANOG FoxO3 binding siteForward: TGAGGCAAAGAGCATTGTTG
Reverse: TGATGAAGGAATGGGCATAA