Table S1.

Oligonucleotide sequence of shRNAs

shRNAClone IDSequence
SLC7A11 #1NM_014331.2–1384s1c1 CCGGCCTGCGTATTATCTCTTTATTCTCGAGAATAAAGAGATAATACGCAGGTTTTTG
SLC7A11 #2NM_014331.3–1995s21c1 CCGGTATTCTATGAGTCGCACAATTCTCGAGAATTGTGCGACTCATAGAATATTTTTG
GCLM #1NM_002061.2–840s21c1 CCGGCCAAATAGTAACCAAGTTAATCTCGAGATTAACTTGGTTACTATTTGGTTTTTG
GCLM #2NM_002061.1–842s1c1 CCGGCCACCAGATTTGACTGCATTTCTCGAGAAATGCAGTCAAATCTGGTGGTTTTTG
Nanog #1NM_024865.2–1135s21c1 CCGGAGATGAGTGAAACTGATATTACTCGAGTAATATCAGTTTCACTCATCTTTTTTTG
Nanog #2NM_024865.2–1047s21c1 CCGGACAGCAGACCACTAGGTATTTCTCGAGAAATACCTAGTGGTCTGCTGTTTTTTTG
FoxO3 #1NM_001455.x-2766s1c1 CCGGCATGTTCAATGGGAGCTTGGACTCGAGTCCAAGCTCCCATTGAACATGTTTTTG
FoxO3 #2NM_001455.3–1105s21c1 CCGGGGACAATAGCAACAAGTATACCTCGAGGTATACTTGTTGCTATTGTCCTTTTTG