Table S1.

Primers used for RT-PCR

GeneForward (5′ to 3′)Reverse (5′ to 3′)
Lsi1GCCAGCAACAACTCGAGAACAACATGGTAGGCATGGTGCCGT
Lsi6CGTTGATTCGTTGTCCTAGATAGGATATCACCTTCTTGAGGAGGTT
Lsi2ATCTGGGACTTCATGGCCCACGTTTGATGCGAGGTTGG
Lsi3CTGTATCCCTGTTGCCAGCTGTAATCCGGCATGCGTACTTG
SIET3ATTAAGCACGGATATCATGGTGCGATTTTCTCTTCTCCTGCCTATAC
SIET4AAGCAGACGGTGATTGAGAAGGGCATGTGCAGTTGTACAAACACC
SIET5GATGGATGCAGATGGGGACTGCCAAGTTCCATCGACTGGGTC
ActinGACTCTGGTGATGGTGTCAGCGGCTGGAAGAGGACCTCAGG