Table S1.

Primers used to generate in situ hybridization probes

GeneForward primerReverse primer
nfkbiaaatggatttacacagagccgcaatctatctcccacagagccggatg
nfkbiabatggagctttaccgaggcaccactactgccccatcactttaatatcatc
nfkb1aaacctcgcgttgatctcgagacttgcggttcttctcgct
P65ctgtcgaggaggagacgagaagtttctgtcgggtgctctg
creltgcggttcttcactcagacctccgagttgaccaatggagc
relbaggacatcccataccgtccacaagcactggaggaggaagg