Table S1.

Primer sequences used in qRT-PCR analysis

Target geneSequence
Human TKTForward, GAAGATCAGCTCCGACTTGG
Reverse, GTCGAAGTATTTGCCGGTGT
Human HPRTForward, CTTTGCTGACCTGCTGGATT
Reverse, CTGCATTGTTTTCGGAGTGT
Human NRF2Forward, GGTTGCCCACATTCCCAAAT
Reverse, AGCAATGAAGACTGGGCTCT
Human BACH1Forward, TAGTGTGGAGCGAGAAGTGG
Reverse, ACCTAACCACGGACACTCAG
Human KEAP1Forward, CCTTCAGCTACACCCTGGAG
Reverse, AACATGGCCTTCAAAACAGG
Human TKT site 1, ChIPForward, CTTCACAAGTGGGCAGTGTC
Reverse, AACCCAGTTCCCACCTAGTG
Human TKT site 2, ChIPForward, GAGGCCACAGAAGAGCAGTA
Reverse, GCAGGAAAAGGCCCTCAAC
Human TKT site 3, ChIPForward, TGAGGCCAGGAGTTCAAGAC
Reverse, CAAAGTGCTGGGATTAAAGGG
Human TKT site 4, ChIPForward, GTGTGCGAGAATGTTGGTACT
Reverse, CTCCAATCAGCGCTCCCA
Human TKT site 5, ChIPForward, AGCACCATCTAAAGGTCCCT
Reverse, CCTGGCCCACATATCCTGAG
Human TKT site 6, ChIPForward, AGAGTACAACCCCAGCAGC
Reverse, CCACGCCACAAAGCAAGTTA
Human TKT site 7, ChIPForward, GAAGGGGAGCGGGAGATG
Reverse, TCTCCTCCTGCCTGTACATG