Table S10.

Primer and overgo sequences

GenePrimerSequence (5′-3′)ApplicationPrimerBank ID
P.a IFN-α1IFN-α1–1FATGGCCCTGCCCTGTTCCloning to pcDNA6.2/EmGFP
IFN-α1–1RATCCTTAYTCCTTGATCTTTCCCloning to pcDNA6.2/EmGFP
IFN-α1–2FACCCGGCAGACCTTCCATaqMan qPCR
IFN-α1–2RCGTTGATAAGGAGTAGGATCTCATGACTaqMan qPCR
IFN-α1pAGAGGTCTCGTCCGCAGCTTGGGATTaqMan qPCR probe
P.a IFN-α2IFN-α2–1FATGGCTATGCCTTTTTCCCloning topcDNA6.2/EmGFP
IFN-α2–1RATCCTTAYTCCTTGATCTTTCCCloning to pcDNA6.2/EmGFP
IFN-α2–2FCAAGGATAGAGAAGATTTTGGATTCCTTaqMan qPCR
IFN-α2–2RAGTCCAGTGCAGAATCTGCCTAATaqMan qPCR
IFN-α2pCATCCATGAGGTGACCTGGCAGACCTaqMan qPCR probe
P.a IFN-α3IFN-α3–1FGCAGAATTCCCACCATGGCCCTGCCCTGTCloning to pCAGGS
IFN-α3–1RGCACTCGAGTTACTTGTCGTCATCGTCTTTGTAGTCATCCTTACTCTTTGACloning to pCAGGS
IFN-α3–2FCTGGGACAAATGAGGAGAATCTCTTaqMan qPCR
IFN-α3–2RACGACAGCGATGGCTTGAATaqMan qPCR
IFN-α3pCATTTCATGGCAACCCCTTCCAGGATaqMan qPCR probe
C.b IFN-αC.b_IFN-α-1FATGCTCCTGGGACAAATGAGSYBR qPCR
C.b_IFN-α-1RGAAGAGGTGGAAGGTCTGCSYBR qPCR
P.a IFN-βIFN-β-1FATGACCAACAGGTGCATCCTCCloning to pcDNA6.2/EmGFP
IFN-β-1RGTTTTGGAGGTATTCTGTAAGCloning to pcDNA6.2/EmGFP
IFN-β-ovaACAAGGACAGGATGGACTTCAAGCBAC library probing
IFN-b-ovbTTAATCTCCGCAGGGAGCTTGAAGBAC library probing
C.b IFN-βC.β_IFN-β-2FAACTTGATAGGCAGATGGACCSYBR qPCR
C.β_IFN-β-2RAGTGTCGTGCTTTCCCAGSYBR qPCR
P.a 18s rRNA18s-1FCGGCTACCACATCCAAGGAATaqMan qPCR
18s-1RGCTGGAATTACCGCGGCTTaqMan qPCR
18spTGCTGGCACCAGACTTGCCCTCTaqMan qPCR probe
P.a IFN-εIFN-εpaTGATTAGCAAGTACTTCTTTGAAGBAC library probing
IFN-εpbAGCAGCACCAACACAACTTCAAAGBAC library probing
P.a KLHL9KLHL9paGGGTGATGGAGATGAAATCTTCCCBAC library probing
KLHL9pbCATAGCTCTGTGAACGGGGAAGATBAC library probing
pCC1FGGATGTGCTGCAAGGCGATTAAGTTGGBAC end sequencing
pCC1RCTCGTATGTTGTGTGGAATTGTGAGCBAC end sequencing
gDNAgDNA-1FCATGGACTTGCCTGGAAGCCCAATCTCGenome DNA PCR
gDNA-1RCCACAGAGTAAATGGATCCACTTGenome DNA PCR
Pa Mx1Pa Mx1FGTTGCAGATGTATGGCATGGSYBR qPCR
Pa Mx1FAACAGCCGAGTGTTGCTCTTSYBR qPCR
Hu Mx1Hu Mx1FGTTTCCGAAGTGGACATCGCASYBR qPCR222136618c1
Hu Mx1RCTGCACAGGTTGTTCTCAGCSYBR qPCR
Pa IFI35Pa IFI35FTTTGGGAAGACGAAGAATGGSYBR qPCR
Pa IFI35RGATCCGATCTCAGCCTTCTGSYBR qPCR
Hu IFI35Hu IFI35FAACAAAAGGAGCACACGATCASYBR qPCR306922357c1
HuIFI35RCTCCGTTCCTAGTCTTGCCAASYBR qPCR
Pa OAS1Pa OAS1FAGCTGGAAGCCTGTCAAAAASYBR qPCR
Pa OAS1RGTAGCTTCTCGGCACCTGACSYBR qPCR
Hu OAS1Hu OAS1FAGTTGACTGGCGGCTATAAACSYBR qPCR74229012c3
Hu OAS1RGTGCTTGACTAGGCGGATGAGSYBR qPCR
HES4HES4FTCAAGACCCTCATCCTGGACSYBR qPCR (specific for human and bat)
HES4RACCTCTGCCAGACACTCGTTSYBR qPCR (specific for human and bat)
c19orf66Hu_ c19orf66_FCTCCATCGTGTACGGGGTAAASYBR qPCR (specific for human and bat)154350197c1
Hu_ c19orf66_RGGTCCTGCTTCATATCCTCTGGTSYBR qPCR (specific for human and bat)