Table S15.

Oligonucleotide primers used

NameSequencePurpose
pCaryP-attP-F2GCGGCAACCCTCAGCGConstruction of line pf40
pCaryP-attP-R1ACGTGTCCACCCCGGTCAConstruction of line pf40
Adh-CDS-F2AAGCAAAAAAGAAGTCACCATGTCConstruction of line pf40
Adh-exon2-R2CAGGTTCTAGGATTGAATACACGAConstruction of line pf40
Adh_vir_AF1TTggcgcgcCTTATCAGTAAATTTACGAGTGGTTTGTAmplify vir Adh LHS
Adh_vir_il3FGCAAACCGTAAGTCCATTGTCTACAmplify vir Adh center
Adh_vir_il3RGTAGACAATGGACTTACGGTTTGCAmplify vir Adh LHS
Adh_vir_ir1FTAGCCGAGACATTGCTGTTGAGAmplify vir Adh RHS
Adh_vir_ir1RCTCAACAGCAATGTCTCGGCTAAmplify vir Ah center
Adh_vir_NR1ATGTTAgcggccgCTGTTTTGCTGTCTGAATTTTGTGAmplify vir Adh RHS
Adh_vir_s3aAF1CCCGGGCGAATTCGCCggcgcgccTTATCAGTAAATTTACGAGTGGTTTGTAmplify vir Adh with Gibson ends for pS3aG
Adh_vir_s3aNR1CTGATTATGATCTAGAGTCgcggccgcTGTTTTGCTGTCTGAATTTTGTGAmplify vir Adh with Gibson ends for pS3aG
csr34FGCGCTGACTTTGAGTGGAATGTCAmplify vgQ-lacZ
pGBQ_S3aAcsr34FTGGCGGCCGCGGGAATTCGATGCTCTTCCACGGACATGCTAAGGGTTAATCAACGCGCTGACTTTGAGTGGAATGTCAmplify vgQ-lacZ with Gibson ends for pGem-T-Easy
pGBQ_S3aNsv40R2CCGCGAATTCACTAGTGATGCTCTTCGACATTCCACTCAAAGTCAGCGCGTTGATTAACCCTTAGCATGTCCGTGAmplify vgQ-lacZ with Gibson ends for pGem-T-Easy
qrAdhvir-2FCTATTGCGGTAAACTTTACGGGCACGqRT-PCR vir Adh
qrAdhvir-2RTACACCAGTAATAGGCGCCAGTCTGqRT-PCR vir Adh
Rp49-dl2FCGCCCAGCATACAGGCCCAAGAqRT-PCR Rp49 (RPL32)
Rp49-dl2RACCAGGAACTTCTTGAATCCGGTGGqRT-PCR Rp49 (RPL32)
S3a_F2CACATGTGCAAGAGAACCCAGTGSequence inserts in pS3aG
S3a_R5GCATTCATTTTATGTTTCAGGTTCASequence inserts in pS3aG
sv40-R2GTTGATTAACCCTTAGCATGTCCGTGAmplify vgQ-lacZ
va_S01_RACTGATGACTTTTGGTTTAAGTATTTCTASequence vir Adh
va_S02_RCAGCCGAACGGCATTGATTSequence vir Adh
va_S03_FTACACAAGAGCATTACATTACCTAGACACSequence vir Adh
va_S04_FATAGCTGCGCATGCATGATASequence vir Adh
va_S05_RCGTGTGCTTTGTGTGTTGGTAGASequence vir Adh
va_S06_FCGGCAAGGGAACACTAAAAASequence vir Adh
va_S07_RGACAATCTCCCGACTGGTGTSequence vir Adh
va_S08_FTTGCCAAGCTGAAGACTGTGSequence vir Adh
va_S09_RGATCGTCCAAAATGCCAGCSequence vir Adh
va_S10_FTGGGCGAGCTACTTCTTGAGSequence vir Adh
va_S11_RGCCTCAATGGCCTTAACAAASequence vir Adh
va_S12_FAAATGTGGTTGGTTGCTTTTCASequence vir Adh
va_S13_RTGGAGTAATCGAATTTGCAACGSequence vir Adh
va_S14_FAATAAAATCTTCCTTTTGCAGGTTACSequence vir Adh
va_S15_RAACCTGCAAAAGGAAGATTTTATTACSequence vir Adh
va_S16_FGAGCATTTATTATTCAAGCAAGATSequence vir Adh
va_S17_RTATCTTGCTTGAATAATAAATGCTCSequence vir Adh
va_S18_FTAGACATAGGTCAACATTTCCGATTSequence vir Adh
va_S19_RAATCGGAAATGTTGACCTATGTCTSequence vir Adh
va_S20_FCCAATCAAAAGTTGCGTGTGSequence vir Adh
va_S21_RCACACGCAACTTTTGATTGGSequence vir Adh
va_S22_FAAATGGCGTATACCGCAAAASequence vir Adh
va_S23_RCAGCAGAAGCCAGCAAACGSequence vir Adh
va_S24_RGCTGTGCTTGTTGTTCTTGCSequence vir Adh
va_S25_FGATACGGATGGATTTGCTACGASequence vir Adh
va_S30_FGCCGACGAGTTGCCAATGSequence vir Adh
va_S31_RGACTCAATCCGCTTGTTCTGTGSequence vir Adh
va_S32_FGTCACACCTCTGGGATGTCAATSequence vir Adh
vgQ-F1CGATTGTACTTTGTCGTTTCTAATTGSequence vgQ-lacZ
vgQ-R1CCCTCCGGAGACCGGGGGCCCAAAAATAGSequence vgQ-lacZ
vgQ-seqout-F1ACGCATAGTGCGGTCCTGCACSequence vgQ-lacZ
vgQ-seqout-R1CTCCAGTTGTTGGATATTTTTCTCTCGSequence vgQ-lacZ
vgQseq_10200RCAGACGCCACTGCTGCCAGGSequence vgQ-lacZ
vgQseq_10500FTAACGCCTGGGTCGAACGCTGGSequence vgQ-lacZ
vgQseq_10800RGCAGTAAGGCGGTCGGGATAGTSequence vgQ-lacZ
vgQseq_11000FTGGCTGAATATCGACGGTTTCCATATGGSequence vgQ-lacZ
vgQseq_11300RTACCCGTATCACTTTTGCTGATATGGSequence vgQ-lacZ
vgQseq_11600FATGAATGGGAGCAGTGGTGGAATGCSequence vgQ-lacZ
vgQseq_11900RAGACACTCTATGCCTGTGTGGAGSequence vgQ-lacZ
vgQseq_12200FTCACTGCATTCTAGTTGTGGTTTGTCCSequence vgQ-lacZ
vgQseq_7300FTGACGACTTCTGGCTTCTGGTACGSequence vgQ-lacZ
vgQseq_7700FTATAAATAGAGGCGCTTCGTCTACGGASequence vgQ-lacZ
vgQseq_7900RGATTCACTTTAACTTGCACTTTACTGCAGASequence vgQ-lacZ
vgQseq_8300FGTTACGATGCGCCCATCTACACCASequence vgQ-lacZ
vgQseq_8500RATGAAACGCCGAGTTAACGCCATCASequence vgQ-lacZ
vgQseq_8800FTTGCGTGACTACCTACGGGTAACAGSequence vgQ-lacZ
vgQseq_9000RGTGTGCAGTTCAACCACCGCASequence vgQ-lacZ
vgQseq_9300FTGGATGAAGCCAATATTGAAACCCACGSequence vgQ-lacZ
vgQseq_9600RTTTGATGGACCATTTCGGCACAGCCSequence vgQ-lacZ
vgQseq_9900FCGCATCCAGCGCTGACGGAAGCSequence vgQ-lacZ
vgQstapleL-F2CACGGACATGCTAAGGGTTAATCAACGCGCTGACTTTGAGTGGAATGTCAmplify staple fragments to make vgQ-lacZ duplicate
vgQstapleL-R2GCCGCGGGAATTCGATTCGTGGCGATTTATGACCCGATAACGAmplify staple fragments to make vgQ-lacZ duplicate
vgQstapleR-F2GCGAATTCACTAGTGATTCTCGAATTGGTCGACCTGCAGCCAAmplify staple fragments to make vgQ-lacZ duplicate
vgQstapleR-R1GACATTCCACTCAAAGTCAGCGCGTTGATTAACCCTTAGCATGTCCGTGAmplify staple fragments to make vgQ-lacZ duplicate
vir_S26_FACTAGAAGTCCGTGTCAGGAATCTAASequence vir Adh
vir_S29_RGTACACTGATTCATAAGAGACATACATCCSequence vir Adh