Table S3.

Other primers

Conc, nMNameSequence (5′ to 3′)
Initial PCR
 600Calpha RevACACATCAGAATCCTTACTTTGTG
 600Cbeta RevGCAGTATCTGGAGTCATTGAGG
 600StepoutATTGGGCAGGTTGTCCCTGATT
First nested PCR
 200Calpha nest 1AATCGGTGAATAGGCAGACAGAC
 200Cbeta nest 1TGATGGCTCAAACACAGCG
 1,550Valpha blockTTTTTTTATTGGGCAGGTTGTCCCTGATTTTT/3PHOS/
 1,550Vbeta blockTTTTTTTAATCAGGGACAACCTGCCCAATTTT/3PHOS/
Second nested PCR
 400Calpha nest2CAAGCAGAAGACGGCATACGAGATINDEXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNTCAGGGTTCTGGATAT
 400Cbeta nest2AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNXXXXCCTCGGGTGGGAACAC
  • INDEXX, internal indices used to differentiate among samples; NNNNN, zero to eight randomized nucleotides to provide cluster diversification for the MiSeq analysis; XXXX, a second set of internal indices used to differentiate among samples.