Table S2.

Oligonucleotide primers used in this study

Primer namePrimer sequenceTarget and purpose
pQBR57_TrfA_FAGACGTGACCCTGGAATTGGpQBR57_0001, identifying plasmid presence
pQBR57_TrfA_RTGGTCGGATTTGAACCGTCG
pQBR57_UvrD_FCTTCGAAGCACACCTGATGpQBR57_0131, identifying plasmid presence
pQBR57_UvrD_RTGAAGGTATTGGCTGAAAGG
Tn5042_MerA_FTGCAAGACACCCCCTATTGGACmerA, identifying presence of mercury reductase
Tn5042_MerA_RTTCGGCGACCAGCTTGATGAAC
KT2440_FATGGCAATGTCCGCAATCCISPpu10, identifying P. putida KT2440 (48)
KT2440_RCGGAAGCCTCTGAACACG
SBW25_FACTGCATTCAAAACTGACTGA16S DNA, identifying P. fluorescens SBW25 (49)
SBW25_RAATCACACCGTGGTAACCG
  • All PCRs were performed with the following thermocycling program: 5 min at 95 °C, followed by 30 cycles of 30 s at 95 °C, 30 s at 58 °C, and 1 min at 72 °C, followed by final extension for 5 min at 72 °C.