Table S1.

Primers used in this study

GeneAnogamDPrimerSequence (5′–3′)Product size, bp
CYP4G16PAAGAP001076-PAFq16PA (q)GAAGTTGCGTCGGACGTAAATATGCTATG200
Rq16PA (q)GTCTTCGATTTGCGTTGACGTGGTTC
Fs16PA (s)GGCAGCCTTTGATACCGGTACGCG
Rs16PA (s)GGCCTTCCACTGTGTTTGTCTTGG
pENTR4R5ic (e)ATTCAGTCGACTGGATCCGG
CPRfusF2ic (e)GGGTTGTATAGATGTAGTTGA
CYP4G16PD1AGAP001076-PDFqs16PD1 (q and s)ATGTCAGCAACAATTGCGCATACA1,650
Rqs16PD1 (q and s)TTAACATAGCATATTTACGTCCTGAAAAAAGGAA
CYP4G17AGAP000877Fab17 (ab)CATATGAAGCGCCAACTGAAGATCC258
Rab17 (ab)GGATCCTCATTGCGAGATGAAGGCCGG
Fs17 (s)CCATGGGCATTGAAACGATCCCGG
Rs17 (s)GAGCTCTCATGCCCTCGGCTCCAGC
CYP4G16AGAP001076Fab16 (ab)CATATGCTGCGCCATCGTAAAATG255
Rab16 (ab)GGATCCTCAACCAAATGAAAGGCCTTCC
Fri16 (ri)TAATACGACTCACTATAGGGAGACGCTAGAGAAGAG701
Rri16 (ri)TAATACGACTCACTATAGGGAGAGTAGTCCGTTGC
Ribosomal S7AGAP010592FqS7 (q)AGAACCAGCAGACCACCATC170
RqS7 (q)GCTGCAAACTTCGGCTATTC
GFPFriGFP (ri)TAATACGACTCACTATAGGGAGAACGTAAACGGCCACAAGTTC653
RriGFP (ri)TAATACGACTCACTATAGGGAGACTTGTACAGCTCGTCCATGCC
  • ab, primers used for making antibodies; e, expression primers; q, primers used for RT-PCR; ri, primers used for RNAi; s, primers used for sequencing.