Table S3.

Primer information for the studies

PrimerSequencesProduct size, bpApplication
 L-F1ccattatcagttactcaacctagaat691T7E1 assay for L1 (226 & 463bp) & L2 (411 & 278bp)
 L-R1ctagagacacattctaagtgtgacat
 L-F2gtgaatccaagagtgtgatgaataca806T7E1 Assay for L3 (325 & 481bp)
 L-R2gaatgtcacacttagaatgtgtctct
 L-F3gatctgttcttgtatgttctgttcca897T7E1 Assay for L4 (727 & 170bp)
 L-R3ctctgttggtgacactgtacaatagt
 R-F1gaagggccttgagcatctggatt1,145T7E1 assay for R1 (381 & 764bp), R2 (258 & 847bp), R3 (655 & 490bp) & R4 (1002 & 143bp)
 R-R1ggtgtaagacaagggtctgattt
 L-F1ccattatcagttactcaacctagaat14,740 (no-deletion)Detection of deletion
 R-R1ggtgtaagacaagggtctgattt995 (L1-R1 deletion)
1,270 (L2-R2 deletion)
1,630 (L3-R3 deletion)
2,820 (L4-R4 deletion)
 P1atgggggcatcaaagtatca∼199Detection of L2-R3 deletion
 P4aagttaggactgagaagaatttgaaagg
 P3gactgtcctgtgagcccttctt152Detection of No-deletion
 P4aagttaggactgagaagaatttgaaagg
 HBA-Sgcc ctg gag agg atg ttc101Real-time PCR for HBA expression
 HBA-ASttc ttg ccg tgg ccc tta
 HBB-Stga gga gaa gtc tgc cgt tac87Real-time PCR for HBB expression
 HBB-ASacc acc agc agc ctg ccc a
 HBG-Sggt tat caa taa gct cct agt cc134Real-time PCR for HBG expression
 HBG-ASaca acc agg agc ctt ccc a
 Cas9-HindIII 5′ -Sgccccgtcgtgaagagaagcttcatcc1,887Fragment of cas9-T2A
 Cas9-3′T2A5′-ASgcagggatcctctgccctcctttttcttttttgcctggccggcctt
 T2A3′-Egfp-5′-Scagaggatccctgctaacatgtggtgacgtcgaggagaatcctggcccaatggtgagcaagggcgaggagctgttc747Fragment of T2A-GFP
 EGFP-EcoR1-AScgtagaattcggccgctttacttgtacagctcgtccatgccga
 T2A3′-mCherry5′-Scagaggatccctgctaacatgtggtgacgtcgagg766Fragment of T2A-mCherry
agaatcctggcccaatggtgagcaagggcgaggaggataaca
 mCherry –EcoR1-AScgtagaattcttacttgtacagctcgtccatgccgccggt
Primer for off-target analysis
 HBD-Fccattatcagttactcaacctagaat691For L2 gRNA on-target
 HBD-Rctagagacacattctaagtgtgacat
 CNTN-6-Fgaacaatagagccaccctacaaatagt470For L2 gRNA off-target
 CNTN-6-Rcttcatctcctagagtaaaggtatcct
 Serpina11-Fcagccagcatccttctgctgtgacact590For L2 gRNA off-target
 Serpina11-Rctaacacatggaaggtgcttagtagat
 HBB-Fgaagggccttgagcatctggatt1,145For R3 gRNA on-target
 HBB-Rggtgtaagacaagggtctgattt
 PLEKHA7-Fgggcgtggtggcacatgcttgt680For R3 gRNA off-target
 PLEKHA7-Rgggagagagatgaggagcagca
 CLPB-Fgactcacagttcctcattgct735For R3 gRNA off-target
 CLPB-Rctaggtattctcctgccttct
 LOC101928989-Fgggaatatgatccaaaggagcaa554For R3 gRNA off-targte
 LOC101928989-Rcttattggcctttctcctcat
 DDX10-Fgttcatgtcccatcactatgat648For R3 gRNA on-target
 DDX10-Rgtatgttgtgtctttgtcctcact
 GRIK4-Fgaatgtggtcaacaaagcttca463For R3 gRNA on-target
 GRIK4-Rccagccattctcctgcctca
 CACNB4-Fgcaacactcttaggaaggtctt651For R3 gRNA on-target
 CACNB4-Rgcctttgaagaagatagtggaat
 HECW2-Fccttctcctatacagtaagcca656For R3 gRNA on-target
 HECW2-Rccctaaggataatgatagata
 ERBB4-Fgggcaaagatgaagtcagtgttt444For R3 gRNA on-target
 ERBB4-Rcggttcaagtctcactgattt