Table S1.

Primers used in this work

Purpose and primer namePrimer sequence (5′→3′)
Forward primerReverse primer
Genotyping of insertion lines
dao1-1TTCCCCACGGAATTAAG GTACCTATGGGGAAAAAGGTTCC TG
dao1-2DAGCGGTTTGAG ATAC ATGTGGTTGGTGGACTTG AAGC TATGG
dao1-3TGAAACATCCCC ATC TCTC ACATAAATTTG GGCCC AAAAGTG
dao1-4DTCCGTTTAGTTCCCCC ATATCTCGTGTTTTGGG TCTC CTATG
 Gh3.3GTGACAGGCAG AG TCACAAG CTTTTAACGTATTAATC TTGGC ACG
 Gh3.4CAATGACGGGATTTTGATC ACTGTGGAGCGGAATTATG AAAC
 Gh3.5AGGCCAGTGTTG TTGTC TTTGTGGTCTTGAGCATAG ATTCCG
 Gh3.6GCAAAAACAGC ACC AAC ACG ACGCAGCTTTGGAG GTTTC TG A
 LBb3.1ATTTTGCCGATTTC GG AAC
 LB1GCCTTTTCAGAAATGG ATAAATAG CCTT GCTTCC
 Lba1TGGTTCACGTAG TG GGCC ATCG
 3′dSpmTACGAATAAGAGCG TCC ATTTTAG AGT
Cloning
 At1g14130proCACCTTCCATAGAAATGTATATG TGATCTTCAATGG AG AG GTTAAC
 At1g14130gfpCACCTTCCATAGAAATGTATATG TGTTTATCTAGTCC TGC ATGG G
 At1g14130cdsCACCATGGGGGAACTAAACG GTCATTTATCTAGTC CTG CATG
qRT-PCR
 qDAO1TCGAAGCTTCTGC AG ATCAATTTCCTCGCTAAATCC GTTG
 qDAO2CCAGTGGATAG AG ATCTTG AAGCGGCTTGTATAG TCGC GG ATG
 qGH3.2GTTTGCTTCCGGTC TCCTCCACGAGCAAGTTCCTTCC A
 qGH3.3CATCACAGAGTTCCTC AC AAGCGTCGGTCCATGTCTTC ATC A
 qRSL4TCTCTTGGGGATGTTCAAC TTTAGGCCAAGCAAC TCG TCTC
 qACT2CCGCTCTTTCTTTCCAAGCCCGGTACCATTGTC AC AC AC