Table S5.

Oligonucleotides used in this study

OligonucleotideSequence (5′–3′)Purpose
ML072TTATTGCAAACCGAAATTATTAGAAAGTTGTTGGTCesxA RT primer
ML073CTATTTAAACCATCTAATCTTTTGATAAGCTTGGTTTGCGessC RT primer
ML074CTACTTATTTAATATTCTTCTAATATTTCTTTCACCATTAATTTCesaD RT primer
ML075TTAGATTAATCTCTCTTTCTTAAAGTGTTTTATAAACATGTTCAGesaA RT primer
ML092TTAATTCATTGCTTTATTAAAATATTCACTTGCCesxC RT primer
ML135ATGCATCGGATCCCCTTAGGAGGATGATTATTTATGATTAGCAAAATTAATGGTAAATTATTTGCCGATATGATTATACAAGGGGfakA SmaI pMK4 forward
ML136GACGGCCAGTGAATTTTATTCTACTGAAAAGAAATATTGfakA EcoRI pMK4 reverse
ML169ATATGTCGACAGCACCGCTATAGGCGCGΔfakA pIMAY F1
ML170GACTCTTTTATTAAAATTTTATAAAGTCGTCCTCCTAAA ATATACTCATAGCAATGΔfakA pIMAY R1
ML171GTATATTTTAGGAGGACGACTTTATAAAATTTTAATAAAAGAGTCTATATTGTAATTGGAAATTATCTCTCGΔfakA pIMAY F2
ML172ATATGAATTCTGTCTCTTTCTAATGGCTCGAACAATATGΔfakB1 pIMAY R2
ML203TACGGTTGGATCCCCATGACAATGATGGATATGAATTcrtMN SmaI pMK4 forward
ML204GACGGCCAGTGAATTTTATACGCCCCGCTCAATAcrtMN EcoRI pMK4 reverse
ML205ATATGTCGACGTACTAATTACCGGTGATTCAGGAATAGGTΔlgt pIMAY F1
ML206CCTCAAACTATCATCAACCTACTCCTCACTCTTATGΔlgt pIMAY R1
ML207GTGAGGAGTAGGTTGATGATAGTTTGAGGAAATTTTTATCAAAAACACΔlgt pIMAY F2
ML208ATATGAATTCAAAATTGTCACCTCCTAATCATTTTTATATACΔlgt pIMAY R2
MLqPCR08ACACGTGCACAAGGTGAAATesxA qPCR forward
MLqPCR09GTTGTTGGAATTGCTCTTCGesxA qPCR reverse
MLqPCR10FAM-TGACCTTCCCAGTTCGCTGCA-BHQ1esxA qPCR probe
MLqPCR17ATCGGAAGTCCAGGATATGGessC qPCR forward
MLqPCR18TTGGTACCGAAATCGAACAAessC qPCR reverse
MLqPCR19FAM-TGTTGCAAGACACCATCGTCCTGA-BHQ1essC qPCR probe
MLqPCR20GCCCCTTAGTGCTGCAGCTArrsA qPCR forward
MLqPCR21AGTTTCAACCTTGCGGTCGTArrsA qPCR reverse
MLqPCR22VIC-CGCATTAAGCACTCCGCCTGGG-BHQ1rrsA qPCR probe
MLqPCR26AATCATGGAAGGACTTTCGCesaD qPCR forward
MLqPCR27CGCCTTTGAAGCCTAATTTCesaD qPCR reverse
MLqPCR28FAM-TCCCAGCACCTTTGAGGAAGCC-BHQ1esaD qPCR probe
MLqPCR38GAAGTCAATGGCGTTGCTAAesaA qPCR forward
MLqPCR39CCACAACACTCGTTGCTTTCesaA qPCR reverse
MLqPCR40FAM-TTCATCTTGACGATTTGCTTGTCCAAA-BHQ1esaA qPCR probe
MLqPCR47TTGAAAGCACAGCAAAGGACesxC qPCR forward
MLqPCR48GCTTGAAATGTTGGGTGAAGesxC qPCR reverse
MLqPCR49FAM-AAGGGAAAGGCGCCCAATACG-BHQ1esxC qPCR probe