Table S1.

Primer sequences of cloning and sequencing primers

PrimersSequences
RT-PCR
 FwdExon15′–AGAGACCCATGGGGAACTG–3′
 RevExon55′–CCCATCAGCTCCACAAAATC–3′
 FwdLacZ5′–CCGGATTGATGGTAGTGGTC–3′
 FwdGAPDH5′–ACTCCACTCACGGCAAATTC–3′
 RevGAPDH5′–CACATTGGGGGTAGGAACAC–3′
Long-range PCR
 Fwd3′ allele5′–TACCGCCTCCAACAATGA–3′
 Rev3′ allele5′–TGACTCAGGAGCTCTCAG–3′
Cloning of wild-type CABP2-pEGFP-N1
 FwdS15′–GAGAGGATCCGGGAACTGTGCCAAGCGG–3′
 RevS15′–CTCCCGGTCGAGT TGGGTGGCGGCAAT–3′
 FwdS25′–ACCCAACTCGACCGGGAGCTGCGGCCC–3′
 RevS25′–TAATACGACTCACTATAGG–3′
  • Fwd, forward; Rev, reverse.