Table S4.

Primers used for ChIP-qPCR analysis

GeneSensePrimer 5′–3′
Ppara (−801; −632 bp)ForwardTCTCCCCATTTCTCATCCTG
Ppara (−801; −632 bp)ReverseGCCAGGACTGAAGTTCAAGG
Ppara (unrelated region)ForwardGTAGCTGTGACCACCCACCT
Ppara (unrelated region)ReverseGACCCTGCATGAACTTTGGT