Table S3.

Primers for quantitative real-time PCR

SpeciesGenePrimer 1 (5′–3′)Primer 2 (5′–3′)
A. thalianaAtZat12 (At5g59820)TGGGAAGAGAGTGGCTTGTTTTAAACTGTTCTTCCAAGCTCCA
A. thalianaAtWRKY40 (AT1G80840)ACGAGCCCAACGTCAAGAATTCCGGTAACAGCTGCTGCTA
A. thalianaAtWRKY53 (AT4G23810)GCCATTACCCAAAAGCCAAAGGCGTATCAGGGAACGAGAA
A. thalianaAtPP2AA3 (AT1G13320)ACCTGCGGTAATAACTGCATCTAACCAAGCATGGCCGTATCAT
S. pennelliiSpEF1a (XM_015223530)CACCCCCAAGTACTCCAAGGGTCGAGGTTGGTAGACCTCTC
S. pennelliiSpPI-II (XM_015214393)ATCAATTGTTGCTCAGGCTATAAGGGATCACAATTTAGGGTGCAAG
N. tabacumNtTPI (DQ158189)CACAGAGTTAGCTTCCTTGCGATCACAATTTAAGGGACAAGC
N. tabacumNtEF2 (AJ299247)TGCTGGTACACAAGCTCATCAAAGTCACTGCCTGCTTCAAACC