Table S3.

List of primers used in the study

Amplicon and primerSequence (5′–3′)Annealing temperature (°C)
Amplicon 1
 ITS-Poa-fAAGGATCATTGTCGTGACC51
 ITS4TCCTCCGCTTATTGATATGC
Amplicon 2
 ITS-Poa-fAAGGATCATTGTCGTGACC51
 ITS-Pan-bacACACTGCACCGAGAACAAC
Amplicon 3
 Pas_141FATATTGCCTTGCGAGGGTGA55
 Pas_435RTGCACCATGGCACGAGAG
 Pan1_162FGTTCGGCCTGTCGCGCAT55
 Pan1_486RACATGCAGGTGCCCGACA
 Pan2_65FAAGGCCCCCAGTCAACATTT60
 Pan2_484RCGTGCAAGTACCTAACACGG
 Euc_140FTATTGACTTGCTCGGCGGAG60
 Euc_481RTGCTGTGCCCGATACGATTC
 Set_31FCGTGTCATCCATGCCGCAT55
 Set_202RAGATAGCATCGTTACACGAGGT
 Aru_49FGGGCTTCGGTCCGGTTTA54
 Aru_168RGCCGACCGCTCCACCGT
  • ITS-Poa-f is from ref. 34. ITS4 is from ref. 55. ITS-Pan-bac is from ref. 18. Genus-specific primers are from this study.